Review



mouse actb qpcr primer pair  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech mouse actb qpcr primer pair
    Mouse Actb Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/database+primer+qpcr+qprimerdb/pm42082500-224-25-36
    Average 86 stars, based on 1 article reviews
    mouse actb qpcr primer pair - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Self-assembling scaffolds epigenetically reactivate and electroactively guide neuronal regeneration to restore central neural circuits.
    Article Snippet: Anti-mouse CD80-FITC antibody (Cat No: 11-0801-82) and Anti-mouse CD206-PE (Cat No: 12-2061-82) were purchased from eBioscience (San Diego, CA, USA). .. Mouse Jun qPCR primer pair (Cat No: 102595), mouse Fos qPCR primer pair (Cat No: 38359), mouse Klf6 qPCR primer pair (Cat No: 103985) and mouse Actb qPCR primer pair (Cat No: 10343) were purchased from Sangon Biotech Co., Ltd (Shanghai, China). .. All the other chemical reagents and solvents were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China) unless specified.



    Similar Products

    mouse actb qpcr primer pair  (Sangon Biotech)
    86
    Sangon Biotech mouse actb qpcr primer pair
    Mouse Actb Qpcr Primer Pair, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/database+primer+qpcr+qprimerdb/pm42082500-224-25-36
    Average 86 stars, based on 1 article reviews
    mouse actb qpcr primer pair - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    β actin gene  (OriGene)
    93
    OriGene β actin gene
    β Actin Gene, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pm41369341-121-5-14
    Average 93 stars, based on 1 article reviews
    β actin gene - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    actb  (OriGene)
    93
    OriGene actb
    Actb, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pmc12590768-32-0-6
    Average 93 stars, based on 1 article reviews
    actb - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    primers targeting β actin  (OriGene)
    93
    OriGene primers targeting β actin
    Primers Targeting β Actin, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pm40864867-329-0-6
    Average 93 stars, based on 1 article reviews
    primers targeting β actin - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    cat tgc tga cag gat gca gaa gg  (OriGene)
    93
    OriGene cat tgc tga cag gat gca gaa gg
    Cat Tgc Tga Cag Gat Gca Gaa Gg, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pm40753732-116-57-67
    Average 93 stars, based on 1 article reviews
    cat tgc tga cag gat gca gaa gg - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    mouse β actin primers  (OriGene)
    93
    OriGene mouse β actin primers
    Mouse β Actin Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pmc12204606-124-0-4
    Average 93 stars, based on 1 article reviews
    mouse β actin primers - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    origene mp200232 nm 007393 fwd  (OriGene)
    93
    OriGene origene mp200232 nm 007393 fwd
    Origene Mp200232 Nm 007393 Fwd, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pmc11474052__pnas__2415934121__sapp-152-40-40
    Average 93 stars, based on 1 article reviews
    origene mp200232 nm 007393 fwd - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    β actin mp200232  (OriGene)
    93
    OriGene β actin mp200232
    β Actin Mp200232, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pm39073417-29-22-24
    Average 93 stars, based on 1 article reviews
    β actin mp200232 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    mouse actin fp cattgctgacaggatgcagaagg origene cat  (OriGene)
    93
    OriGene mouse actin fp cattgctgacaggatgcagaagg origene cat
    Mouse Actin Fp Cattgctgacaggatgcagaagg Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pmc11224269__41467_2024_49978_MOESM1_ESM-130-280-283
    Average 93 stars, based on 1 article reviews
    mouse actin fp cattgctgacaggatgcagaagg origene cat - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    housekeeping gene β actin  (OriGene)
    93
    OriGene housekeeping gene β actin
    Housekeeping Gene β Actin, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+actb+qpcr+primer+pair/Actb+Mouse+qPCR+Primer+Pair/pm36930296-136-5-26
    Average 93 stars, based on 1 article reviews
    housekeeping gene β actin - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results